WebSynapsin-driven, Cre-dependent and Flp-dependent channelrhodopsin-EYFP expression for optogenetic activation. These AAV preparations are suitable purity for injection into animals. Delivery Volume 100 µL Titer ≥ 7×10¹² vg/mL Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid. Storage Store at -80℃. WebPrecision Diagnostic Approach, When Minutes And Complete Information Matter In emergency, trauma, critical care settings, rapid diagnosis of bleeding and clotting risk …
Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View
WebSep 12, 2024 · In order to express the Flp recombinase in mammary gland epithelial cells, we placed the mouse codon-optimized Flp ( Flpo) under the control of the MMTV promoter. Transgenic mice were generated by pronuclear microinjection. 17 founder animals were obtained, of which ten showed germline transmission. WebFlp recombinase Use Cre/Lox, Lentiviral, and RNAi Tags Expression Mammalian Mutation Promoter Availability Academic Institutions and Nonprofits only Enlarge pCAG-FlpO Plasmid #89574 Purpose Expresses FlpO under pCAG Depositor Wilson Wong Article Weinberg et al Nat Biotechnol. 2024 Mar 27. doi: 10.103 Insert FlpO Use Cre/Lox and Synthetic Biology csgoxainshi
AbbVie’s Tau Antibody Flops in Progressive Supranuclear Palsy
WebSee our retrograde AAV based on the functional catagories listed below. Narrow down the items available within a category by using the buttons. Controls Green Red Switch Other Recombinases Cre Flp VCre Dre Calcium Sensors GCaMP8f GCaMP8s GCaMP8m GCaMP7f GCaMP7s GCaMP7b GCaMP6f GCaMP6s GECO Other Biosensors … Webflp recombinase Alt name EFS promoter driving FlpO recombinase Insert Size (bp) 212 Entrez Gene flp Promoter EF1a/EFS promoter inserted Cloning Information Cloning method Restriction Enzyme 5′ cloning site SnaI (destroyed during cloning) 3′ cloning site XbaI (not destroyed) 5′ sequencing primer ccagtacatgaccttatggg WebThe first version of FLP discovered has a temperature optimum of 30 °C and is therefore inefficient in mammalian cells (usually grown at 37 °C). Smart molecular evolution led … csgoxianshixianwei